Faculty

Walter Goodman
Professor
608-262-6919
608-262-3322

740 Russell Laboratories
1630 Linden Drive
Madison, WI 53706
 

Ph.D. Northwestern University - Evanston, 1978 (Biology)
MS    University of California-Davis, 1972 (Entomology)
BS     University of California-Davis, 1970 (Entomology)

 

Insect metamorphosis and reproduction is the result of an exquisite interplay between genes, hormones, physiology and abiotic factors. Integrating these processes are small acyclic sesquiterpenoid molecules, the juvenile hormones (JHs). The central role of JH in orchestrating the insect life cycle and reproductive events has not gone unnoticed among agroecologists, chemists, and entomologists who are concerned with developing better strategies for insect pest management. That we know almost nothing about the molecular mode of action of this family of hormones and synthetic agonists poses serious questions about the use of these unique molecules. Thus, it is crucial that we decipher the molecular action of the hormone before further expanding the use of the JH agonists in pest management.

To better understand the action of JH at the molecular level, we have taken several approaches. Discovery that a JH specific hemolymph transport protein (hJHBP) is positively regulated by JH suggested a model in which to study the molecular actions ofthe hormone. The gene structure ofhJHBP as well as flanking regions was elucidated. Promoter analysis probing the 5' upstream region of the hJHBP gene as well as regions in the first intron indicated that control of hJHBP expression is complex. (NIH,USDA funding). Our inability to clearly delineate promoters led us to shift our attention towards more tractable models. We identified a JH-regulated gene critical to a cyclic AMP (cAMP) activated signal transduction pathway in Drosophila S2 cells. This gene, Epac, (Exchange Protein directly Activated by cAMP) regulates cell shape, movement and cell-cell adhesion and is consistent with the known morphostatic actions of JH in insects.

We are now in a position to examine the initial events in JH regulation of gene expression focusing on a problem that has long baffled insect endocrinologists ­ a JH receptor (Hatch funding). The goals of our present research are: (1) isolate and characterize the JH receptor (JHR) from Drosophila S2 cells. (2) Clone and express recombinant JHR (rJHR) to examine binding pocket dimensions. Perform pull-down experiments with the immobilized rJHR to catalog proteins that potentially interact with the receptor. (3) Characterize the JHR in vivo. Discovery and characterization of this receptor will be of exceptional importance for several reasons. It has been a long­ held concept that development of a JH antagonist would be an excellent candidate for control of larval pests by specifically blocking the hormone receptor site thereby forcing the insect to develop prematurely. By developing a molecular model of the receptor's binding site, the development of more potent antagonists as well as agonists may be achieved. Understanding these associations will unlock the enigma of JH action and provide new molecular targets that can be disrupted in an environmentally sound fashion.

Suborganismal

ENT 201: Insects and Human Culture (3 Cr), every spring semester
PLATO Bugs, Beetles, and Bipeds (NCr), every spring semester
 

College of Agricultural and LIfe Sciences, UW-Madison, Spitzer Award for Excellence in Teaching   2002                    
Entomological Society of America, North Central Branch, Distinguished Teaching Award                   2002
Entomological Society of America, National,  Distinguished Teaching Award                                         2002
UW- Madison, Distinguished Teaching Award - Chancellors Award                                                         2003

Entomological Society of America
American Association for the Advancement of Science
Pacific Coast Entomological Society
 

Publications since 2000

Young, J.K. and Goodman, W.G. (2001) Review of Visual Cloning 2000: A software tool for genetic mapping. Insect Biochemistry and Molecular Biology  31:933-934.

Goodman, W.G.,  Jeanne, R.,  Sutherland, P. (2001) Teaching about behavior with the Tobacco Hornworm. The American Biology Teacher 63:258-261.  

Noriega, F.G. Edgar, K.A., Goodman, W.G., Shah, D.K., Wells, M.A. (2001) Neuroendocrine factors affecting the steady state levels of early trypsin mRNA in Aedes aegypti. Journal of Insect Physiology 47:515-522.

Bede, J.C., Teal, P.E.A., Goodman, W.G., Tobe, S.S. (2001) Biosynthetic pathway of insect juvenile hormone III in the sedge Cyperus iria L. Plant Physiology 127: 584-593.

Orth, A.P., Doll, S., Goodman, W.G. (2003) Structure and expression of the hemolymph juvenile hormone binding protein from Manduca sexta. Insect Biochemistry and Molecular Biology  33:93-103.

Mohamed, M.A., Hogg, D.B., Park, Y.C., Goodman, W.G. (2003) Dot-blot immunoassay detection of Microtonus aethiopoides (Braconidae, Euphorinae) an adult endoparasitoid in Alfalfa Weevil Hypera postica. Biocontrol Science and Technology 13:631-640.

Orth, A.P., Tauchman, S.J., Doll, S.C., Goodman, W.G. (2003)  Embryonic expression of juvenile hormone binding protein and its relationship to the toxic effects of juvenile hormone in Manduca sexta. Insect Biochemistry and Molecular Biology 33:1275-1284.

Young, J.K., Orth, A.P., and Goodman, W.G. (2003) Allelic variation in the hemolymph  juvenile hormone binding protein gene of Manduca sexta. Molecular and Cellular Endocrinology  208:41-50.

Tauchman, S.J., Lorch, J.M., Orth, A.P., Goodman, W.G. (2007) Effects of stress on the hemolymph juvenile hormone binding protein titers of Manduca sextaInsect Biochemistry and Molecular Biology 37:847-854.

Wang, J., Lindholm, J.R., Willis, D.K., Orth, A.P., Goodman, W.G. (2009) Juvenile hormone regulation of Drosophila Epac - A guanine nucleotide exchange factor.  Molecular and Cellular Endocrinology 305:30-7.

Willis, D.K., Wang, J., Stanford, J.R, Orth, A.P., Goodman, W.G. (2010) Microarray analysis of juvenile hormone response in Drosophila melanogaster S2 cells.  Journal of Insect Science 10:66.

Pérez-Hedo, M., Goodman, W.G., Schafellner, C. Martini, A., Sehnal, F., Eizaguirre, M. (2011) Control of larval-pupal-adult molt in the moth Sesamia nonagrioides by juvenile hormone and ecdysteroids. Journal of Insect Physiology (in Press)

Book Chapters:

Goodman, W.G. and Granger, N.A. (2005)  The Juvenile Hormones  In  Comprehensive Molecular Insect Science (ed. by L.I. Gilbert, K. Iatrou, S. Gill). Vol 3 pp. 319-408. Elsevier, Amsterdam

Goodman, W.G. and Cusson, M. (2011) The Juvenile Hormones. In Comprehensive Molecular Insect Science (ed. by L.I. Gilbert). Vol 7 (in press). Academic Press, San Diego.

Website:

Guiney, J., Bashaw, S., Goodman, (2006) Website, Manduca in the classroom.         http://manduca.entomology.wisc.edu

Outreach
Manduca Manual for Teachers

Research
Our laboratory is interested in the physiological, biochemical and molecular aspects of insect endocrinology. The major ongoing projects include:

  1. An analysis of the physiological roles of the hemolymph juvenile hormone binding protein
  2. The molecular structure of the hemolymph juvenile hormone binding protein
  3. The molecular action of juvenile hormone on gene expression

Overview
One of the most astonishing of all biological events is that of insect metamorphosis. At the most fundamental level, insects restructure anatomical, physiological and molecular processes to interact with new environments. Despite the profound difficulties involved in metamorphosis, a life cycle that permits a single species to temporarily exploit different environments, yields immense benefits for that species. Remodeling of the insect to fit the new niche is orchestrated by the insect endocrine system.

Feeding and the concomitant increase in volume creates a problem for an insect encased in it's own skeleton. Because the overstretched exoskeleton prevents further expansion, it must be shed to permit a new skeleton to take its place. The process of building a new exoskeleton and subsequent shedding the old is initiated by the molting hormone 20-hydroxyecdysone; however, the direction of the molt is dictated by the presence or absence of another family of hormones termed the juvenile hormones. During the growth phase of the immature insect, levels of the juvenile hormones are relatively high. If a molt occurs in the presence of high levels of juvenile hormone, the next stage will be larval. If a molt occurs when the levels juvenile hormone are low, the ensuing stage will be pupal.

The Juvenile Hormones
The juvenile hormones (JH) are a family of acyclic sesquiterpenoid compounds synthesized by the corpora allata, a small set of paired glands immediately behind the brain. While JH III is the predominant form found in many species of insects, there are other forms of the hormone. These hormones are the most nonpolar of all metazoan hormones. Because there are no endocrinological cognates in vertebrates, analogs of the hormones are used in insect pest control.

figure 1

Figure 1. Structures of the Common Insect Juvenile Hormones and Cognates
 

Transport of JH Via Specific Transport Proteins
The JHs display low solubility in water; more importantly, the hormones readily and nonspecifically associate with surfaces of a less hydrophilic nature. Thus, peripheral distribution of the hormone would pose a serious problem were it not for specific high affinity transport proteins that serve as an intermediate between the site of synthesis and the target tissue. Although present in all insects, the most well characterized of the hemolymph juvenile hormone binding proteins (hJHBP) is that from the tobacco hornworm, Manduca sexta.

The hJHBP from M. sexta is composed of a single subunit, has a molecular weight of 27.4 kDa and displays an equilibrium dissociation constant of 1 x 10-9 M for JH I. The protein is 226 amino acid residues in length and is glycosylated, with the carbohydrate residues accounting for about 8% of the molecular mass. (Fig. 2).

Figure 2. Deduced Amino Acid Sequence of Manduca sexta hJHBP.

A complete analysis of the mature fat body hJHBP mRNA indicates that the message contains 862 nucleotides (nt). The translational start site as determined by 5' rapid amplification of cDNA ends begins 40 nt upstream from the canonical ATG of the signal peptide. A wild-type genomic library from a single feeding fifth stadium female was generated to study the structure of the hJHBP gene. We have isolated 20 kb of contiguous genomic DNA, containing the entire hJHBP open reading frame. The open reading frame is composed of 5 exons. For a complete nucleotide sequence see http://www.ncbi.nlm.nih.gov, GenBank Accession Number AF226657.

The initial analysis of the 5' flanking region indicates a TATA-like box (5' TATATATA 3') at positions -31 to -24 relative to the transcriptional start site. The gene contains the canonical arthropod capsite sequence (5' TCAGT 3') at -2/+3 position. Analyses of a portion of the 5' flanking region (~1700 nt) identified CCAAT box sequences, E box sequences, and hepatocyte nuclear factors (HNF)1 and 4 binding sequences. HNF-4 plays an important role in regulating the transcription of sex hormone binding globulin, a serum hormone binding protein found in vertebrates. Ecdysteroid response elements are presentat approximately -6000.


 

Figure 3. Spatial Organization of the M. sexta hJHBP Gene. Sequence analysis indicates that the open reading frame extends over 6.7 kb. Exons are numbered 1 - 5 and are mapped onto hJHBP (Orth et al., 2003). Putative disulfide bridges and carbohydrate attachment sites are shown below. Tryptic footprinting demonstrates that only residues 1 to 179 are required for JH binding.


Allelic Variation in hJHBP
A comparison of hJHBP from three strains of Manduca indicates that hemolymph levels of the protein in the Madison wild-type (Mwt) strain are significantly higher than those found in the Seattle wild-type (Swt) or the black larval (bl) strains; Young et al., 2003). To correlate differences in hJHBP levels between the three strain phenotypes, we sequenced 8.4 kb of the hJHBP gene from each strain. Sequence data about these alleles can be found at http://www.ncbi.nlm.nih.gov/ GenBank Accession Numbers AF527636 (Swt) and AF527635 (bl). Snb, the hJHBP allele found in the Swt and bl strain, contains a 408 bp repetitive nuclear element flanked by 15 bp direct repeats. Mating studies using the Mwt (Md allele) and Swt (Snb allele) strains coupled with molecular genotyping demonstrated that the presence of Snb correlates with a twofold lower hJHBP level relative to the allele found in offspring containing the Md allele. Despite the lower hJHBP levels in individuals carrying the Snb gene, hemolymph levels of JH do not appear to be significantly affected.

 

Figure 4. hJHBP titers of the MwtSwt, and bl strains of Manduca sexta. For each strain, hJHBP titers were determined by EIA in 12 individual 2nd gate, fourth stadium animals 50 hours post-ecdysis. Box plots represent the 25th, 50th, and 75th percentiles. The whiskers represent the 10th and 90th percentiles. The mean hJHBP titer for each strain is displayed with a bold solid line.

Figure 5.Comparison of the Md and Snb alleles of Manduca sextahJHBP. Vertical bars E1-E5 represent exons. Breaks in Snb represent the absence of sequence (>5 bp) when aligned with Md. Hollow boxes in Snb represent the insertion of sequence (>5 bp) when aligned withMd.

 

5'- GAATGGACGGGCATATATTTTTTTGTCCATATATAATATAATAATAATAT 50

    
    CAGCCCTGTATTATATACTTGCCCACTGCTGAGCACGGGCCTCCTCTACT 100
	
    ACTGAGAGGGAGGGATTAGGCCCTTGTCCACCACGCTGGCCTAGTGCGGA 150
     
    TTGGTAGACTTATCACACCTTCTAAATTCCTATAGAGAACTTCTCAGATG 200
                      
    TGCAGTTTTCCTTACGAAGTTTTCCTTCACCGTTAAAGCGAACGATAAAT 250

    TCACAAAGAATACACACATGATTTTAGAAAAGTCAGAGGTGTGTGCTCTT 300
                       
    GGGATTTGAACCTGCGGACATTCGCCTTGGCAATCCGTTCCACACCCAAC 350

    TAGGCTATCGCCGCTTATATGTCCTTATTTTTTTGTCCATGCAGAGACTA 400
							      
    TAGCGACG-3'

Figure 6. Sequence of Ms1. Direct repeats are presented in bold.


Biological Studies

Analysis of JH distribution in the larval body indicates that approximately 95% of the hormone is found in the hemolymph. Of the hormone found in the hemolymph, virtually all is temporarily associated with hJHBP, thus making the protein central to hormone delivery and clearance. Not surprisingly, expression of the hJHBP gene is tightly regulated, adjusting rapidly to modulate JH titers. Developmental profiles for hJHBP suggest that the protein may be regulated by factors other than those that govern the levels of the major hemolymph proteins. This is best seen int the profile for hJHBP from the fourth stadium of wild-type M. sexta. hJHBP displays a dramatic 6-fold fluctuation, while during the same period levels of total hemolymph proteins vary only 2-fold. It remains unclear whether target cells interact with bound or unbound hormone. Nevertheless, with 95% of the insect’s total JH associated with this single protein, regulation of the hJHBP level is critical to the regulation of the peripheral JH titer.


 

Figure 7. Levels of hJHBP during the fourth stadium of the wild-type Manduca sexta. Levels of hJHBP were determined using a monoclonal based enzyme-linked immunosorbent assay.

 

It has long been known that pigmentation of the bl strain of M. sexta is exceedingly sensitive to JH during certain periods of development. Using that analogy, we examined the role of JH in regulating hJHBP gene expression. We discovered that JH rapidly induced the hJHBP mRNA abundance (Orth et al., 1999). Topically applied JH (100 pg) rapidly (4 hours) induces a 6-fold increase in the abundance of hJHBP mRNA. More recently, using real-time PCR, we have noted a similar response in our wild-type strain.

Our challenge is to understand how this unique hormone regulates the expression of its transport protein. Using this as a model, we hope to decipher the larger problem of how JH modulates insect development.

Work in Progress

Structural studies
Obtaining sufficient, highly purified hJHBP for biological experiments and structure determination is tedious. We have turned to a bacterial expression system to generate milligram amounts of the protein. Experiments are currently being conducted on clarifying how the hormone interacts with its binding site by creating mutations and truncations in the recombinant protein. Parallel work is focusing on protein structure via crystallography. Towards this end, we are collaborating with crystallographers to develop the appropriate crystals of hJHBP needed for structural analysis.

Functional analyses of regulatory elements
With better than 12 kb of sequenced 5' flanking region, we have begun to use functional analyses to determine which regions of the gene represent regulatory elements. Towards that end, we have cloned a series of upstream regions into reporter constructs to determine which regions may be important in JH regulation. This work is funded by the NIH.

In addition to these studies, we are currently assessing the effect of JH III on Drosophila S2 cells. This work is being carried out collaboratively with Dr. Tony Orth at Genomics Institute of the Novartis Research Foundation, San Diego.

Joliene Lindholm
Graduate Student

Syndicate

Syndicate content